Top » Catalog » SNPs » S24464

$18.00

S24464
[S24464]

S24464
hg38 Position: ChrY:20438012..20438012
Ancestral: T
Derived: C
Reference: Jim Wilson (2014)
ISOGG Haplogroup: T1a2b1
Comments: Below L446
Forward Primer: S24464_F GGGGAGATGGAAATATTTACTGG
Reverse Primer: S24464_R GGTTAGGAAGAAGATGGAAAAAGG
Reviews

Customers who bought this product also purchased
Y144975
Y144975
Y144958
Y144958
FGC47681
FGC47681
T Superclade Panel
T Superclade Panel
FGC47689
FGC47689
Y144967
Y144967
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies