Top » Catalog » SNPs » Y7438

$18.00

Y7438
[Y7438]

Y7438
hg38 Position: ChrY:12076198..12076198
Ancestral: T
Derived: C
Reference: Yfull (2015)
ISOGG Haplogroup: T1a2b2a
Comments: Below FGC23029/Y7388; aka FGC23024
Forward Primer: Y7438_F TTTTCTTACAGACATAAGCCTTCTG
Reverse Primer: Y7438_R CTTGCACTAACTAAGGCTCTAAAGATG
Reviews

Customers who bought this product also purchased
Y144975
Y144975
FGC47681
FGC47681
Y144958
Y144958
FGC23029
FGC23029
FGC1350
FGC1350
CTS11451
CTS11451
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies