Top » Catalog » SNPs » Y7438

$18.00

Y7438
[Y7438]

Y7438
hg38 Position: ChrY:12076198..12076198
Ancestral: T
Derived: C
Reference: Yfull (2015)
ISOGG Haplogroup: T1a2b2a
Comments: Below FGC23029/Y7388; aka FGC23024
Forward Primer: Y7438_F TTTTCTTACAGACATAAGCCTTCTG
Reverse Primer: Y7438_R CTTGCACTAACTAAGGCTCTAAAGATG
Reviews

Customers who bought this product also purchased
Y144975
Y144975
FGC47681
FGC47681
Y144958
Y144958
FGC1350
FGC1350
CTS11451
CTS11451
T Superclade Panel
T Superclade Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies