Top » Catalog » SNPs » Y8850

$19.00

Y8850
[Y8850]

Y8850
hg38 Position: ChrY:20756093..20756093
Ancestral: C
Derived: G
Reference: Yfull (2015)
ISOGG Haplogroup: T1a1a1b2b2b1a1a1b2a1 (not listed)
Comments: Below FGC4037/Y8425; aka FGC4062
Forward Primer: Y8850_F AAAGTCCCGTGGCATAACTG
Reverse Primer: Y8850_R CCGCACTCTTCTCAGACCTC
Reviews
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies