Top » Catalog » SNPs » CTS6507

$18.00

CTS6507
[CTS6507]

CTS6507
hg38 Position: ChrY:14837673..14837673
Ancestral: T
Derived: C
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: T1a1a1b2b2b1a1a
Comments: below FGC4009/Y4956
Forward Primer: CTS6507_F AGTGTTTCTATCCTCAGTCATTACAA
Reverse Primer: CTS6507_R GGATCCAATTTTTCTAAATTGGGTC
Reviews

Customers who bought this product also purchased
T-P77 Panel
T-P77 Panel
CTS6280
CTS6280
T Superclade Panel
T Superclade Panel
Z714
Z714
Y21005
Y21005
Y24138
Y24138
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies