Top » Catalog » SNPs » CTS6507

$18.00

CTS6507
[CTS6507]

CTS6507
hg38 Position: ChrY:14837673..14837673
Ancestral: T
Derived: C
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: T1a1a1b2b2b1a1a
Comments: below FGC4009/Y4956
Forward Primer: CTS6507_F AGTGTTTCTATCCTCAGTCATTACAA
Reverse Primer: CTS6507_R GGATCCAATTTTTCTAAATTGGGTC
Reviews

Customers who bought this product also purchased
FGC30207
FGC30207
Y11596
Y11596
CTS11451
CTS11451
CTS9882
CTS9882
FGC30201
FGC30201
M70
M70
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies