Top » Catalog » SNPs » Y15127

$18.00

Y15127
[Y15127]

Y15127
hg38 Position: ChrY:22217735..22217735
Ancestral: C
Derived: T
Reference: YFull (2015)
ISOGG Haplogroup: T1a1a1b2a
Comments: Below CTS2214
Forward Primer: Y15127_F CAAGCAATTCTCCTGCGTG
Reverse Primer: Y15127_R CAAATTGGCTTAGAGATAAATAAGCATG
Reviews

Customers who bought this product also purchased
M267
M267
Y10906
Y10906
Y4124
Y4124
Y15712
Y15712
Y15717
Y15717
P77
P77
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies