Top » Catalog » SNPs » FGC19359

$18.00

FGC19359
[FGC19359]

FGC19359
hg38 Position: ChrY:20041440..20041440
Ancestral: G
Derived: C
Reference: Full Genomes Corp. (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below DF13
Forward Primer: FGC19359_F GGCCCTTCTCACTTCCTACC
Reverse Primer: FGC19359_R TCACAGAGAGAAGAGCATCCAC
Reviews

Customers who bought this product also purchased
FGC19344
FGC19344
FGC19349
FGC19349
FGC19335
FGC19335
FGC19357
FGC19357
FGC19343
FGC19343
FGC19348
FGC19348
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies