Top » Catalog » SNPs » Z709

$18.00

Z709
[Z709]

Z709
hg38 Position: ChrY:7022681..7022681
Ancestral: T
Derived: C
Reference: Gareth Hanson (2011)
ISOGG Haplogroup: T1a1a1b2b
Comments: Extracted from 1000 genomes data. Below CTS2214
Forward Primer: Z709_F GAATTTTGAGGGAGATTTTTGC
Reverse Primer: Z709_R TGACATAACAGCCACTTTGACC
Reviews

Customers who bought this product also purchased
CTS11451
CTS11451
CTS6507
CTS6507
FGC30201
FGC30201
M70
M70
CTS9882
CTS9882
CTS6280
CTS6280
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies