Top » Catalog » SNPs » Z709

$18.00

Z709
[Z709]

Z709
hg38 Position: ChrY:7022681..7022681
Ancestral: T
Derived: C
Reference: Gareth Hanson (2011)
ISOGG Haplogroup: T1a1a1b2b
Comments: Extracted from 1000 genomes data. Below CTS2214
Forward Primer: Z709_F GAATTTTGAGGGAGATTTTTGC
Reverse Primer: Z709_R TGACATAACAGCCACTTTGACC
Reviews

Customers who bought this product also purchased
T-P77 Panel
T-P77 Panel
Y21005
Y21005
Y24138
Y24138
Z714
Z714
FGC48929
FGC48929
Y16049
Y16049
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Z18008
$18.00
Haplogroup Info
Other products
Currencies