Top » Catalog » SNPs » Z712

$18.00

Z712
[Z712]

Z712
hg38 Position: ChrY:11074713..11074713
Ancestral: C
Derived: T
Reference: Gareth Hanson (2011)
ISOGG Haplogroup: T1a1a1b2b2
Comments: Extracted from 1000 genomes data. Below Z709
Forward Primer: Z712_F CCCAAGTGCCCCTGCCCCAG
Reverse Primer: Z712_R TCTTTTGCAAGACCTGGA
Reviews

Customers who bought this product also purchased
BY28319
BY28319
Y18004
Y18004
Y15127
Y15127
Y41656
Y41656
Y39854
Y39854
L906
L906
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies