Top » Catalog » SNPs » S2000

$18.00

S2000
[S2000]

S2000
hg38 Position: ChrY:6938476..6938476
Ancestral: A
Derived: G
Reference: Jim Wilson (2014)
ISOGG Haplogroup: I1
Comments: .
Forward Primer: S2000_F CCGTTTTACTTTCCTGGTTGAC
Reverse Primer: S2000_R ACAGGAGCCCATAAAAGTGG
Reviews

Customers who bought this product also purchased
YFS251206
YFS251206
Y141809
Y141809
A375
A375
FGC74328
FGC74328
YSC0000261
YSC0000261
FGC74330
FGC74330
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies