Top » Catalog » SNPs » S2000

$18.00

S2000
[S2000]

S2000
hg38 Position: ChrY:6938476..6938476
Ancestral: A
Derived: G
Reference: Jim Wilson (2014)
ISOGG Haplogroup: I1
Comments: .
Forward Primer: S2000_F CCGTTTTACTTTCCTGGTTGAC
Reverse Primer: S2000_R ACAGGAGCCCATAAAAGTGG
Reviews

Customers who bought this product also purchased
S1961
S1961
I1-L338 Hamilton Group Panel
I1-L338 Hamilton Group Panel
A681
A681
A376
A376
A264
A264
A262
A262
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies