Top » Catalog » SNPs » F2642

$18.00

F2642
[F2642]

F2642
hg38 Position: ChrY:15824399..15824399
Ancestral: G
Derived: A
Reference: Yan Shi (2011)
ISOGG Haplogroup: I1a2a1a2
Comments: Found in a hg C person. Also in hg I-Z140
Forward Primer: F2642_F TTAATCCCCCAGGCTTCAG
Reverse Primer: F2642_R GCGATGCTTTCTCTGCACTC
Reviews

Customers who bought this product also purchased
Z62
Z62
A1601
A1601
Y6231
Y6231
CTS6364
CTS6364
S2320
S2320
Z140
Z140
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies