Top » Catalog » SNPs » F2642

$18.00

F2642
[F2642]

F2642
hg38 Position: ChrY:15824399..15824399
Ancestral: G
Derived: A
Reference: Yan Shi (2011)
ISOGG Haplogroup: I1a2a1a2
Comments: Found in a hg C person. Also in hg I-Z140
Forward Primer: F2642_F TTAATCCCCCAGGCTTCAG
Reverse Primer: F2642_R GCGATGCTTTCTCTGCACTC
Reviews

Customers who bought this product also purchased
A1374
A1374
A1603
A1603
A1601
A1601
Y6231
Y6231
Z62
Z62
Z141
Z141
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies