Top » Catalog » SNPs » F2642

$18.00

F2642
[F2642]

F2642
hg38 Position: ChrY:15824399..15824399
Ancestral: G
Derived: A
Reference: Yan Shi (2011)
ISOGG Haplogroup: I1a2a1a2
Comments: Found in a hg C person. Also in hg I-Z140
Forward Primer: F2642_F TTAATCCCCCAGGCTTCAG
Reverse Primer: F2642_R GCGATGCTTTCTCTGCACTC
Reviews

Customers who bought this product also purchased
Y5497
Y5497
A5989
A5989
A13241
A13241
Y3647
Y3647
Y3649
Y3649
BY178134
BY178134
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies