Top » Catalog » SNPs » F2642

$18.00

F2642
[F2642]

F2642
hg38 Position: ChrY:15824399..15824399
Ancestral: G
Derived: A
Reference: Yan Shi (2011)
ISOGG Haplogroup: I1a2a1a2
Comments: Found in a hg C person. Also in hg I-Z140
Forward Primer: F2642_F TTAATCCCCCAGGCTTCAG
Reverse Primer: F2642_R GCGATGCTTTCTCTGCACTC
Reviews

Customers who bought this product also purchased
Y3649
Y3649
BY178134
BY178134
FGC65549
FGC65549
CTS6739
CTS6739
A13959
A13959
CTS2291
CTS2291
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies