Top » Catalog » SNPs » A732

$15.00

A732
[A732]

A732
hg38 Position: ChrY:7063799..7063799
Ancestral: C
Derived: A
Reference: Bruce Cockburn (2014)
ISOGG Haplogroup: R1b1a2a1a1b1a1 (not listed)
Comments: R1b/U106/L257
Forward Primer: A732_F GTAATTGGAATGAGTCAGGGTAGAGT
Reverse Primer: A732_R CATTGCTGATGCCTCTGTG
Reviews

Customers who bought this product also purchased
FGC15270
FGC15270
FGC15271
FGC15271
YSEQ-Alpha-Beta
YSEQ-Alpha-Beta
A736
A736
A735
A735
A733
A733
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies