Top » Catalog » SNPs » A16010

$18.00

A16010
[A16010]

A16010
hg38 Position: ChrY:10010068..10010068
Ancestral: T
Derived: C
Reference: Janet Akaha (2017)
ISOGG Haplogroup: E
Comments: Below BY8506
Forward Primer: A16010_F CGCCAGAGAATTGGACTTTG
Reverse Primer: A16010_R ATGCCATGGAAGGTTTTCAG
Reviews

Customers who bought this product also purchased
Y95956
Y95956
A16012
A16012
A16011
A16011
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies