Top » Catalog » SNPs » A737

$18.00

A737
[A737]

A737
hg38 Position: ChrY:15654309..15654309
Ancestral: G
Derived: A
Reference: Bruce Cockburn (2014)
ISOGG Haplogroup: R1b1a2a1a1b1a1 (not listed)
Comments: R1b/U106/L257
Forward Primer: A737_F TGGAGTATGAGGGCAGTTCC
Reverse Primer: A737_R TTAGGAAAAGGGCATGGAAG
Reviews

Customers who bought this product also purchased
A734
A734
A732
A732
A736
A736
A735
A735
A733
A733
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies