Top » Catalog » SNPs » HU326

$19.00

HU326
[HU326]

HU326
hg38 Position: ChrY:2869658..2869658
Ancestral: T
Derived: C
Reference: Faleh Al Hujailan (2017)
ISOGG Haplogroup: J1a (not listed)
Comments: Below FGC9 > FGC4316
Forward Primer: HU326_F GTCAGAGATGGAGCCCTCAG
Reverse Primer: HU326_R TCATGAATTTCCCACACCTG
Reviews

Customers who bought this product also purchased
BY171056
BY171056
FGC1695
FGC1695
FGC7393
FGC7393
FGC11722
FGC11722
FGC1723
FGC1723
FGC2
FGC2
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies