Top » Catalog » SNPs » FGC18235

$18.00

FGC18235
[FGC18235]

FGC18235
HG19 Position: ChrY:2809331..2809331
Ancestral: C
Derived: G
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: R1b1a2a1a2c1j (not listed)
Comments: Downstream Z251+ FGC13899+
Forward Primer: FGC18235_F TGTGGAAAGTGCTTTTAATACAGTG
Reverse Primer: FGC18235_R CCAATGTGGAAAGAATTTGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies