Top » Catalog » SNPs » FGC19832

$18.00

FGC19832
[FGC19832]

FGC19832
HG19 Position: ChrY:7916248..7916248
Ancestral: T
Derived: C
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: FGC19832_F ATACCTCTGGGCATGTCACC
Reverse Primer: FGC19832_R GTTCATGGGTGTTGTTGAGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies