Top » Catalog » SNPs » FGC19833

$16.00

FGC19833
[FGC19833]

FGC19833
HG19 Position: ChrY:8158606..8158606
Ancestral: T
Derived: C
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: FGC19833_F CCAAGTGTTACCAATACCGAAAC
Reverse Primer: FGC19833_R CCAGGGTAATCGGACAAGAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies