Top » Catalog » SNPs » FGC19833

$18.00

FGC19833
[FGC19833]

FGC19833
hg38 Position: ChrY:8290565..8290565
Ancestral: T
Derived: C
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: R1b
Comments: Below M222 > DF105 > S603 > FGC19831
Forward Primer: FGC19833_F CCAAGTGTTACCAATACCGAAAC
Reverse Primer: FGC19833_R CCAGGGTAATCGGACAAGAG
Reviews

Customers who bought this product also purchased
S7814
S7814
S603
S603
FGC19838
FGC19838
S588
S588
FGC19831
FGC19831
S659
S659
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies