Top » Catalog » SNPs » FGC19838

$18.00

FGC19838
[FGC19838]

FGC19838
hg38 Position: ChrY:19155970..19155970
Ancestral: C
Derived: T
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: R1b
Comments: Below M222 > DF105 > S603 > FGC19833
Forward Primer: FGC19838_F AAGTAGCCAATCGCAAGGTG
Reverse Primer: FGC19838_R CTTGGAGCCTCAGATGGAAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1
$18.00
Haplogroup Info
Other products
Currencies