Top » Catalog » SNPs » M67

$18.00

M67
[M67]

M67
hg38 Position: ChrY:19716923..19716923
Ancestral: A
Derived: T
Reference: Underhill et al. 2001
ISOGG Haplogroup: J2a1b
Comments: Aka S51/PF5137
Forward Primer: M67_F AGCAGAAAGAGGTGTGGGTC
Reverse Primer: M67_R TCCATTAAGTGTTCTCCTGATTTG
Reviews

Customers who bought this product also purchased
PF5401
PF5401
Z7700
Z7700
Y3620
Y3620
L70
L70
FGC21373
FGC21373
SK1363
SK1363
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies