Top » Catalog » SNPs » M67

$18.00

M67
[M67]

M67
hg38 Position: ChrY:19716923..19716923
Ancestral: A
Derived: T
Reference: Underhill et al. 2001
ISOGG Haplogroup: J2a1b
Comments: Aka S51/PF5137
Forward Primer: M67_F AGCAGAAAGAGGTGTGGGTC
Reverse Primer: M67_R TCCATTAAGTGTTCTCCTGATTTG
Reviews

Customers who bought this product also purchased
ZS7528
ZS7528
M172
M172
M267
M267
M9
M9
*TOP* - Top-Level Orientation Panel
*TOP* - Top-Level Orientation Panel
FGC15914
FGC15914
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies