Top » Catalog » SNPs » M67

$15.00

M67
[M67]

M67
hg38 Position: ChrY:19716923..19716923
Ancestral: A
Derived: T
Reference: Underhill et al. 2001
ISOGG Haplogroup: J2a1b
Comments: Aka S51/PF5137
Forward Primer: M67_F AGCAGAAAGAGGTGTGGGTC
Reverse Primer: M67_R TCCATTAAGTGTTCTCCTGATTTG
Reviews

Customers who bought this product also purchased
Z7553
Z7553
Z7503
Z7503
FGC15901
FGC15901
ZS7528
ZS7528
M172
M172
M267
M267
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies