Top » Catalog » SNPs » FGC19839

$18.00

FGC19839
[FGC19839]

FGC19839
hg38 Position: ChrY:19881208..19881208
Ancestral: C
Derived: G
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: R1b
Comments: Below M222 > DF105 > S603 > FGC19831
Forward Primer: FGC19839_F TGGCACTTGCAAATAAGCAG
Reverse Primer: FGC19839_R GGAAAGTAAGTCGCCTGTGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies