Top » Catalog » SNPs » FGC62413

$18.00

FGC62413
[FGC62413]

FGC62413
hg38 Position: ChrY:22362971..22362971
Ancestral: C
Derived: A
Reference: Full Genomes Corp (2017)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: FGC62413_F CTACCAGCAACTATACATAAGATCGAAAG
Reverse Primer: FGC62413_R ACTCCTTTTAATAACAAACTAAAAATTAAAATG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies