Top » Catalog » SNPs » FGC62844

$16.00

FGC62844
[FGC62844]

FGC62844
HG19 Position: ChrY:7050413..7050413
Ancestral: C
Derived: A
Reference: Tim Duncan (2017)
ISOGG Haplogroup: R1b
Comments:
Forward Primer: FGC62844_F CGAACCCACAACTTTCCTTG
Reverse Primer: FGC62844_R AAAGGTGGGATGCAACTCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies