Top » Catalog » SNPs » FGC62847

$18.00

FGC62847
[FGC62847]

FGC62847
HG19 Position: ChrY:15252114..15252114
Ancestral: A
Derived: C
Reference: Tim Duncan (2017)
ISOGG Haplogroup: R1b
Comments:
Forward Primer: FGC62847_F CCTGACCAACATGGTGAAAC
Reverse Primer: FGC62847_R TTCTTGCTTTCTTTTGGGATTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1
$18.00
Haplogroup Info
Other products
Currencies