Top » Catalog » SNPs » FGC62849

$16.00

FGC62849
[FGC62849]

FGC62849
HG19 Position: ChrY:18052646..18052646
Ancestral: C
Derived: T
Reference: Tim Duncan (2017)
ISOGG Haplogroup: R1b
Comments:
Forward Primer: FGC62849_F CCATGCCTTACACAAATTTCC
Reverse Primer: FGC62849_R CTGGCTTTGGGTATGAGGTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies