Top » Catalog » SNPs » HU334

$19.00

HU334
[HU334]

HU334
hg38 Position: ChrY:13804965..13804965
Ancestral: A
Derived: G
Reference: Faleh Al Hujailan (2017)
ISOGG Haplogroup: J1a (not listed)
Comments: Below FGC2
Forward Primer: HU334_F CCAAGAACCCCACATCAGAG
Reverse Primer: HU334_R CTCACAAAAATCCCCCTCAG
Reviews

Customers who bought this product also purchased
FGC5428
FGC5428
FT36360
FT36360
FTB22281
FTB22281
Y337898
Y337898
A27207
A27207
Y198994
Y198994
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies