Top » Catalog » SNPs » A16154

$18.00

A16154
[A16154]

A16154
hg38 Position: ChrY:13436492..13436492
Ancestral: G
Derived: A
Reference: YSEQ (2017)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: A16154_F CAGGACGACTAGAGGCGAAC
Reverse Primer: A16154_R ACACCCTGCTGGTGATTTTC
Reviews

Customers who bought this product also purchased
A17692
A17692
A16332
A16332
A16331
A16331
A16155
A16155
A16335
A16335
R1b-FGC11397 Rox2 Dodds Segregation Panel
R1b-FGC11397 Rox2 Dodds Segregation Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies