Top » Catalog » SNPs » A16154

$18.00

A16154
[A16154]

A16154
hg38 Position: ChrY:13436492..13436492
Ancestral: G
Derived: A
Reference: YSEQ (2017)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: A16154_F CAGGACGACTAGAGGCGAAC
Reverse Primer: A16154_R ACACCCTGCTGGTGATTTTC
Reviews

Customers who bought this product also purchased
A17692
A17692
A16334
A16334
A16333
A16333
A16332
A16332
A16331
A16331
A16155
A16155
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies