Top » Catalog » SNPs » A16155

$18.00

A16155
[A16155]

A16155
hg38 Position: ChrY:2958526..2958526
Ancestral: A
Derived: G
Reference: YSEQ (2017)
ISOGG Haplogroup: R1b
Comments: DF27 Rox2 below FGC11397, aka BY21584
Forward Primer: A16155_F GGGGTGCTGAGAGAAGTCTG
Reverse Primer: A16155_R TTTTTCCCCCTCTTGTTTAGG
Reviews

Customers who bought this product also purchased
BY21586
BY21586
CTS11075
CTS11075
A17692
A17692
A16331
A16331
A16154
A16154
A16335
A16335
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies