Top » Catalog » SNPs » A16155

$18.00

A16155
[A16155]

A16155
hg38 Position: ChrY:2958526..2958526
Ancestral: A
Derived: G
Reference: YSEQ (2017)
ISOGG Haplogroup: R1b
Comments: DF27 Rox2 below FGC11397, aka BY21584
Forward Primer: A16155_F GGGGTGCTGAGAGAAGTCTG
Reverse Primer: A16155_R TTTTTCCCCCTCTTGTTTAGG
Reviews

Customers who bought this product also purchased
BY21586
BY21586
CTS11075
CTS11075
A17692
A17692
A16335
A16335
R1b-FGC11397 Rox2 Dodds Segregation Panel
R1b-FGC11397 Rox2 Dodds Segregation Panel
A16334
A16334
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies