Top » Catalog » SNPs » L1065

$18.00

L1065
[L1065]

L1065
hg38 Position: ChrY:21075436..21075436
Ancestral: C
Derived: T
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: R1b1a1a2a1a2c1k1
Comments: Extracted from 1000 genomes data. Downstream L1335
Forward Primer: L1065v2_F CTCCCTGGTTCTGCCTACAG
Reverse Primer: L1065v2_R ACACGGCTTATGCTGGAGTG
Reviews

Customers who bought this product also purchased
A858
A858
BY62303
BY62303
A23988
A23988
BY156842
BY156842
BY60840
BY60840
BY20833
BY20833
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies