Top » Catalog » SNPs » M9

$18.00

M9
[M9]

M9
hg38 Position: ChrY:19568371..19568371
Ancestral: C
Derived: G
Reference: Underhill et al. 1997
ISOGG Haplogroup: K
Comments: G10.35a
Forward Primer: M9_F CAAAGCGGAAGCTGAAGTG
Reverse Primer: M9_R TCCTCATTTTTGAAGCTCGTG
Reviews

Customers who bought this product also purchased
L879
L879
AMM406
AMM406
Z24084
Z24084
M175
M175
M268
M268
F923
F923
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies