Top » Catalog » SNPs » M9

$18.00

M9
[M9]

M9
hg38 Position: ChrY:19568371..19568371
Ancestral: C
Derived: G
Reference: Underhill et al. 1997
ISOGG Haplogroup: K
Comments: G10.35a
Forward Primer: M9_F CAAAGCGGAAGCTGAAGTG
Reverse Primer: M9_R TCCTCATTTTTGAAGCTCGTG
Reviews

Customers who bought this product also purchased
M70
M70
M4992
M4992
Y77724
Y77724
M5011
M5011
MZ284
MZ284
MZ11
MZ11
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies