Top » Catalog » SNPs » M9

$18.00

M9
[M9]

M9
hg38 Position: ChrY:19568371..19568371
Ancestral: C
Derived: G
Reference: Underhill et al. 1997
ISOGG Haplogroup: K
Comments: G10.35a
Forward Primer: M9_F CAAAGCGGAAGCTGAAGTG
Reverse Primer: M9_R TCCTCATTTTTGAAGCTCGTG
Reviews

Customers who bought this product also purchased
DF19
DF19
U152
U152
FGC15914
FGC15914
Z2227
Z2227
FGC15895
FGC15895
L24
L24
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies