Top » Catalog » SNPs » M9

$18.00

M9
[M9]

M9
hg38 Position: ChrY:19568371..19568371
Ancestral: C
Derived: G
Reference: Underhill et al. 1997
ISOGG Haplogroup: K
Comments: G10.35a
Forward Primer: M9_F CAAAGCGGAAGCTGAAGTG
Reverse Primer: M9_R TCCTCATTTTTGAAGCTCGTG
Reviews

Customers who bought this product also purchased
S1687
S1687
S15627
S15627
S1686
S1686
S1194
S1194
L31
L31
Y176993
Y176993
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies