Top » Catalog » SNPs » M9

$18.00

M9
[M9]

M9
hg38 Position: ChrY:19568371..19568371
Ancestral: C
Derived: G
Reference: Underhill et al. 1997
ISOGG Haplogroup: K
Comments: G10.35a
Forward Primer: M9_F CAAAGCGGAAGCTGAAGTG
Reverse Primer: M9_R TCCTCATTTTTGAAGCTCGTG
Reviews

Customers who bought this product also purchased
PF5125
PF5125
Z6049
Z6049
CTS6433
CTS6433
Z161
Z161
HVR2
HVR2
HVR1
HVR1
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies