Top » Catalog » SNPs » A16315

$18.00

A16315
[A16315]

A16315
hg38 Position: ChrY:14301666..14301666
Ancestral: C
Derived: T
Reference: Judith Simon (2017)
ISOGG Haplogroup: J2
Comments: Below Y9005
Forward Primer: A16315_F TCCACTCTTTTCTGCAAGCTC
Reverse Primer: A16315_R TCTCACATGGCCCTACACAC
Reviews

Customers who bought this product also purchased
A16316
A16316
A16314
A16314
A16313
A16313
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies