Top » Catalog » SNPs » FGC59118

$18.00

FGC59118
[FGC59118]

FGC59118
hg38 Position: ChrY:12697980..12697980
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2017)
ISOGG Haplogroup: J1a (not listed)
Comments: Below FGC5235
Forward Primer: FGC59118_F ATGTCACATTTTCTGTTTATTCCG
Reverse Primer: FGC59118_R TGAAAATACCACATGCACTCTTC
Reviews

Customers who bought this product also purchased
FGC59120
FGC59120
FGC59119
FGC59119
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies