Top » Catalog » SNPs » A16318

$18.00

A16318
[A16318]

A16318
hg38 Position: ChrY:15699602..15699602
Ancestral: A
Derived: G
Reference: Gene Sweetser (2017)
ISOGG Haplogroup: R1b (not listed)
Comments: Below U106 > Z154, approx. CTS8802
Forward Primer: A16318_F CTTGTCTGTTATCTCAGACCTCTGC
Reverse Primer: A16318_R CCTTTCATGTAACCTCTTGAAATG
Reviews

Customers who bought this product also purchased
DNA Sample Kit
DNA Sample Kit
A16317
A16317
DYS549
DYS549
DYS712
DYS712
DYS458
DYS458
DYS533
DYS533
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies