Top » Catalog » SNPs » HU368

$18.00

HU368
[HU368]

HU368
hg38 Position: ChrY:13272249..13272249
Ancestral: T
Derived: C
Reference: Faleh Al Hujailan (2017)
ISOGG Haplogroup: J1a (not listed)
Comments: Below FGC2
Forward Primer: HU368_F GCAAGCCAACAGATTCTTCC
Reverse Primer: HU368_R TCTTTGTCTTGGAGTCTCATGG
Reviews

Customers who bought this product also purchased
FGC11
FGC11
FGC5441
FGC5441
ZS5612
ZS5612
FGC7
FGC7
ZS11269
ZS11269
FT375962
FT375962
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies