Top » Catalog » SNPs » HU368

$18.00

HU368
[HU368]

HU368
hg38 Position: ChrY:13272249..13272249
Ancestral: T
Derived: C
Reference: Faleh Al Hujailan (2017)
ISOGG Haplogroup: J1a (not listed)
Comments: Below FGC2
Forward Primer: HU368_F GCAAGCCAACAGATTCTTCC
Reverse Primer: HU368_R TCTTTGTCTTGGAGTCTCATGG
Reviews

Customers who bought this product also purchased
J1-M267 Superclade Panel
J1-M267 Superclade Panel
ZS8984
ZS8984
FGC45682
FGC45682
FGC1696
FGC1696
CTS9608
CTS9608
ZS9242
ZS9242
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies