Top » Catalog » SNPs » YP6187

$18.00

YP6187
[YP6187]

YP6187
hg38 Position: ChrY:19901283..19901283
Ancestral: G
Derived: A
Reference: YDNA-community (2017)
ISOGG Haplogroup: R1a1a1b1a2a1 (not listed)
Comments: Below YP1696.
Forward Primer: YP6187_F AATCAGTGTTAACTTGTCATCATTTTC
Reverse Primer: YP6187_R CCAATACTATGTGTGTGTTTCTTGC
Reviews

Customers who bought this product also purchased
YP683
YP683
Y58868
Y58868
YP575
YP575
YP1697
YP1697
Y4459
Y4459
YP1696
YP1696
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies