Top » Catalog » SNPs » YP6187

$18.00

YP6187
[YP6187]

YP6187
hg38 Position: ChrY:19901283..19901283
Ancestral: G
Derived: A
Reference: YDNA-community (2017)
ISOGG Haplogroup: R1a1a1b1a2a1 (not listed)
Comments: Below YP1696.
Forward Primer: YP6187_F AATCAGTGTTAACTTGTCATCATTTTC
Reverse Primer: YP6187_R CCAATACTATGTGTGTGTTTCTTGC
Reviews

Customers who bought this product also purchased
A11915
A11915
Y11268
Y11268
BY182582
BY182582
YP683
YP683
Y58868
Y58868
YP575
YP575
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies