Top » Catalog » SNPs » YP6187

$18.00

YP6187
[YP6187]

YP6187
hg38 Position: ChrY:19901283..19901283
Ancestral: G
Derived: A
Reference: YDNA-community (2017)
ISOGG Haplogroup: R1a1a1b1a2a1 (not listed)
Comments: Below YP1696.
Forward Primer: YP6187_F AATCAGTGTTAACTTGTCATCATTTTC
Reverse Primer: YP6187_R CCAATACTATGTGTGTGTTTCTTGC
Reviews

Customers who bought this product also purchased
YP1696
YP1696
Z92
Z92
YP1698
YP1698
R1a-Z280 Panel
R1a-Z280 Panel
Y11268
Y11268
BY182582
BY182582
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies