Top » Catalog » SNPs » A16331

$18.00

A16331
[A16331]

A16331
hg38 Position: ChrY:13960845..13960845
Ancestral: A
Derived: G
Reference: Ed Aber Leek (2017)
ISOGG Haplogroup: R1b
Comments: Below FGC11397
Forward Primer: A16331_F CACACACAAAAACCCAATATACTGG
Reverse Primer: A16331_R TGCTACCTGGGCTAGGCTG
Reviews

Customers who bought this product also purchased
A17692
A17692
A16334
A16334
A16333
A16333
A16332
A16332
A16155
A16155
A16154
A16154
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Z43407
1 x A27664
1 x A27435
$54.00
Haplogroup Info
Other products
Currencies