Top » Catalog » SNPs » A16332

$18.00

A16332
[A16332]

A16332
hg38 Position: ChrY:12268064..12268064
Ancestral: G
Derived: A
Reference: Ed Aber Leek (2017)
ISOGG Haplogroup: R1b
Comments: Below FGC11397
Forward Primer: A16332v2_F AGCCAGACTGGAGCACAGTC
Reverse Primer: A16332v2_R TCCAGAGTAGCTGGGACCC
Reviews

Customers who bought this product also purchased
A17692
A17692
A16333
A16333
A16331
A16331
A16155
A16155
A16154
A16154
A16335
A16335
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies