Top » Catalog » SNPs » A16332

$18.00

A16332
[A16332]

A16332
hg38 Position: ChrY:12268064..12268064
Ancestral: G
Derived: A
Reference: Ed Aber Leek (2017)
ISOGG Haplogroup: R1b
Comments: Below FGC11397
Forward Primer: A16332v2_F AGCCAGACTGGAGCACAGTC
Reverse Primer: A16332v2_R TCCAGAGTAGCTGGGACCC
Reviews

Customers who bought this product also purchased
A17692
A17692
R1b-FGC11397 Rox2 Dodds Segregation Panel
R1b-FGC11397 Rox2 Dodds Segregation Panel
A16334
A16334
A16333
A16333
A16331
A16331
A16155
A16155
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies