Top » Catalog » SNPs » A16334

$18.00

A16334
[A16334]

A16334
hg38 Position: ChrY:20026301..20026301
Ancestral: G
Derived: C
Reference: Ed Aber Leek (2017)
ISOGG Haplogroup: R1b
Comments: Below FGC11397
Forward Primer: A16334_F AAGGGCCACAGTCTCTAATTG
Reverse Primer: A16334_R AGGTTTGCTTGGCAGTTCAC
Reviews

Customers who bought this product also purchased
A17692
A17692
A16331
A16331
A16155
A16155
A16154
A16154
A16335
A16335
R1b-FGC11397 Rox2 Dodds Segregation Panel
R1b-FGC11397 Rox2 Dodds Segregation Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies